Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 628452
End position: 628487
Length: 36

DNA sequence
>NC_008702, from 628452 to 628487 (36 bp); Azoarcus sp. BH72 CGCCGCCTCCGCCGCCGTCGCCGCCGCTGCCGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 628448-628666	Sequence	azo0600 - hypothetical protein (Protein is coded in complementary strand; from 628666 to 628448)