Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 639645
End position: 639668
Length: 24

DNA sequence
>NC_008702, from 639645 to 639668 (24 bp); Azoarcus sp. BH72 GGCGAAGGCGCAGCCGAAGGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 639568-641538	Sequence	azo0611 macB ABC transporter ATP-binding protein/permease (Protein is coded in complementary strand; from 641538 to 639568)