Sequence retrieval

Genome: Azoarcus sp. BH72
Start position: 924045
End position: 924068
Length: 24

DNA sequence
>NC_008702, from 924045 to 924068 (24 bp); Azoarcus sp. BH72 GAGCACGAGCGCGAGCAGGAGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 923623-924912	Sequence	azo0860 - hypothetical protein (Protein is coded in complementary strand; from 924912 to 923623)