Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 1167849
End position: 1167872
Length: 24

DNA sequence
>NC_008817, from 1167849 to 1167872 (24 bp); Prochlorococcus marinus str. MIT 9515 TATCTTTATCCTTATCTTTACCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1167146-1168114	Sequence	P9515_13291 - hypothetical protein (Protein is coded in complementary strand; from 1168114 to 1167146)