Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 1211235
End position: 1211258
Length: 24

DNA sequence
>NC_008817, from 1211235 to 1211258 (24 bp); Prochlorococcus marinus str. MIT 9515 ATTTTTATATTTGTTTTTATTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1210881-1211432	Sequence	P9515_13761 - hypothetical protein (Protein is coded in complementary strand; from 1211432 to 1210881)