Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 1368882
End position: 1368905
Length: 24

DNA sequence
>NC_008817, from 1368882 to 1368905 (24 bp); Prochlorococcus marinus str. MIT 9515 TTTTTACTTTTTTACTTTTTTACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1368886-1369215	Sequence	P9515_15481 - Type I restriction modification DNA s (Protein is coded in complementary strand; from 1369215 to 1368886)