Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 1472496
End position: 1472519
Length: 24

DNA sequence
>NC_008817, from 1472496 to 1472519 (24 bp); Prochlorococcus marinus str. MIT 9515 GAAAATAAAAATGGAAATGAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1471666-1473228	Sequence	P9515_16761 - dolichyl-phosphate-mannose-proteinmannosyltransferase