Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 208162
End position: 208185
Length: 24

DNA sequence
>NC_008817, from 208162 to 208185 (24 bp); Prochlorococcus marinus str. MIT 9515 GATAAATAAATAAATATATAAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 207495-208226	Sequence	P9515_02251 - hypothetical protein (Protein is coded in complementary strand; from 208226 to 207495)