Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 27182
End position: 27205
Length: 24

DNA sequence
>NC_008817, from 27182 to 27205 (24 bp); Prochlorococcus marinus str. MIT 9515 AATTAAAATTAAAAATAAAAGTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 26151-27242	Sequence	P9515_00241 - cyclophilin-type peptidyl-prolyl cis-trans isomerase (Protein is coded in complementary strand; from 27242 to 26151)