Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 354720
End position: 354743
Length: 24

DNA sequence
>NC_008817, from 354720 to 354743 (24 bp); Prochlorococcus marinus str. MIT 9515 ATTTATAAATCTATAAATTTATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 354731-354949	Sequence	P9515_03871 - hypothetical protein (Protein is coded in complementary strand; from 354949 to 354731)