Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 373384
End position: 373407
Length: 24

DNA sequence
>NC_008817, from 373384 to 373407 (24 bp); Prochlorococcus marinus str. MIT 9515 AAAAATAAAAAACTAAAAAAATGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 373146-373400	Sequence	P9515_04131 - hypothetical protein
ORF... 373405-373596	Sequence	P9515_04141 - hypothetical protein