Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 632475
End position: 632498
Length: 24

DNA sequence
>NC_008817, from 632475 to 632498 (24 bp); Prochlorococcus marinus str. MIT 9515 TCTAATTCCAATGCTAATTCTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 631867-632574	Sequence	P9515_06981 - short-chain dehydrogenase/reductase (Protein is coded in complementary strand; from 632574 to 631867)