Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 756121
End position: 756144
Length: 24

DNA sequence
>NC_008817, from 756121 to 756144 (24 bp); Prochlorococcus marinus str. MIT 9515 TAAAATTAAAACAAAAATTAAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 756050-757222	Sequence	P9515_08351 - ABC-transporter, membrane spanning component (Protein is coded in complementary strand; from 757222 to 756050)