Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 1194218
End position: 1194242
Length: 25

DNA sequence
>NC_008817, from 1194218 to 1194242 (25 bp); Prochlorococcus marinus str. MIT 9515 AAAAAAGAAACAAAAAAAACTAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1193583-1194662	Sequence	P9515_13611 - membrane-associated Zn-dependent proteases 1