Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 778344
End position: 778371
Length: 28

DNA sequence
>NC_008817, from 778344 to 778371 (28 bp); Prochlorococcus marinus str. MIT 9515 TATTTTTAATTTTTTATTTATTCTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 778358-778507	Sequence	P9515_08631 - hypothetical protein (Protein is coded in complementary strand; from 778507 to 778358)