Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 1055506
End position: 1055535
Length: 30

DNA sequence
>NC_008817, from 1055506 to 1055535 (30 bp); Prochlorococcus marinus str. MIT 9515 AAAAATTCTTAAAAATATTTATATATTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1055247-1058429	Sequence	P9515_11961 recC exodeoxyribonuclease V subunit C 125 kD polypeptide (Protein is coded in complementary strand; from 1058429 to 1055247)