Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 107018
End position: 107047
Length: 30

DNA sequence
>NC_008817, from 107018 to 107047 (30 bp); Prochlorococcus marinus str. MIT 9515 TTTTTTAAATTTTTCGAAATTTTTTGAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 106974-107312	Sequence	P9515_01061 - hypothetical protein (Protein is coded in complementary strand; from 107312 to 106974)