Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 1208790
End position: 1208819
Length: 30

DNA sequence
>NC_008817, from 1208790 to 1208819 (30 bp); Prochlorococcus marinus str. MIT 9515 AATAAAAATAAGAAGAAAAATTAAAATAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1208221-1209207	Sequence	P9515_13731 rfe hypothetical protein (Protein is coded in complementary strand; from 1209207 to 1208221)