Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 1375407
End position: 1375436
Length: 30

DNA sequence
>NC_008817, from 1375407 to 1375436 (30 bp); Prochlorococcus marinus str. MIT 9515 TATTTAAAGTTATATAAAGGTTTTTAAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1374757-1375434	Sequence	P9515_15581 - phosphatase/phosphohexomutase