Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 1534570
End position: 1534599
Length: 30

DNA sequence
>NC_008817, from 1534570 to 1534599 (30 bp); Prochlorococcus marinus str. MIT 9515 ATTGTTTTTGTTTTTGTTTTTGTTTTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1534456-1534728	Sequence	P9515_17471 - high light inducible protein (Protein is coded in complementary strand; from 1534728 to 1534456)