Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 294931
End position: 294960
Length: 30

DNA sequence
>NC_008817, from 294931 to 294960 (30 bp); Prochlorococcus marinus str. MIT 9515 ATTTTAAACTTTTTTAAAGTATTTTTAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 293860-295296	Sequence	P9515_03181 phrB DNA photolyase (Protein is coded in complementary strand; from 295296 to 293860)