Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 653970
End position: 653999
Length: 30

DNA sequence
>NC_008817, from 653970 to 653999 (30 bp); Prochlorococcus marinus str. MIT 9515 AAAATTAAGAAAAATAAAAACAAATTAATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 653397-653993	Sequence	P9515_07201 - 7TM chemoreceptor (Protein is coded in complementary strand; from 653993 to 653397)