Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 685919
End position: 685948
Length: 30

DNA sequence
>NC_008817, from 685919 to 685948 (30 bp); Prochlorococcus marinus str. MIT 9515 AATTAAATTTAATTGAATCTAATAATATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 685655-686845	Sequence	P9515_07561 purK phosphoribosylaminoimidazole carboxylase ATPase subunit