Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 793338
End position: 793367
Length: 30

DNA sequence
>NC_008817, from 793338 to 793367 (30 bp); Prochlorococcus marinus str. MIT 9515 ATTGTTTTTGTTTTTGTTTTTGTTTTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 793224-793496	Sequence	P9515_08901 - high light inducible protein (Protein is coded in complementary strand; from 793496 to 793224)