Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 150448
End position: 150483
Length: 36

DNA sequence
>NC_008817, from 150448 to 150483 (36 bp); Prochlorococcus marinus str. MIT 9515 CTGCAAGTAATGTTGCAGGTAATGTTGCAGGTAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 150226-151680	Sequence	P9515_01631 plsX glycerol-3-phosphate acyltransferase PlsX