Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 16281
End position: 16316
Length: 36

DNA sequence
>NC_008817, from 16281 to 16316 (36 bp); Prochlorococcus marinus str. MIT 9515 GGCGGCGGCGGTAGAGGCGGCGGTTACGGCGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 16018-16686	Sequence	P9515_00121 - RNA recognition motif-containing protein