Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 11860
End position: 11904
Length: 45

DNA sequence
>NC_008817, from 11860 to 11904 (45 bp); Prochlorococcus marinus str. MIT 9515 AACAGAAACAAGAAGAACAGAAACAAGAAGAACAGAAACAAGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 11800-13047	Sequence	P9515_00091 ftsY signal recognition particle docking protein FtsY