Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 163526
End position: 163570
Length: 45

DNA sequence
>NC_008817, from 163526 to 163570 (45 bp); Prochlorococcus marinus str. MIT 9515 AAGAACAACAACATGAAGAAGAACAACAACATGAAGAAGAACATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 162092-164128	Sequence	P9515_01771 ndhF NAD(P)H-quinone oxidoreductase subunit F