Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 976183
End position: 976236
Length: 54

DNA sequence
>NC_008817, from 976183 to 976236 (54 bp); Prochlorococcus marinus str. MIT 9515 TCATATAATTACTTTAATTACTTTAATTACTTTAATTACTTTAATTACTTTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 975903-976184	Sequence	P9515_11171 - hypothetical protein (Protein is coded in complementary strand; from 976184 to 975903)