Sequence retrieval

Genome: Prochlorococcus marinus str. MIT 9515
Start position: 494543
End position: 494605
Length: 63

DNA sequence
>NC_008817, from 494543 to 494605 (63 bp); Prochlorococcus marinus str. MIT 9515 ATCATGAGAATGGGAAGAGTGATCATGAGAATGGGAAGAGTGATCATGAGAATGGGAAGAGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 494232-495305	Sequence	P9515_05541 - G3E family GTPase (Protein is coded in complementary strand; from 495305 to 494232)