Sequence retrieval

Genome: Methanoculleus marisnigri JR1
Start position: 1073744
End position: 1073767
Length: 24

DNA sequence
>NC_009051, from 1073744 to 1073767 (24 bp); Methanoculleus marisnigri JR1 CGACGGCGTCGGCGCCGGCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1073326-1074507	Sequence	Memar_1085 - bifunctional formaldehyde-activating enzyme/3-hexulose-6-phosphate synthase (Protein is coded in complementary strand; from 1074507 to 1073326)