Sequence retrieval

Genome: Methanoculleus marisnigri JR1
Start position: 1188560
End position: 1188583
Length: 24

DNA sequence
>NC_009051, from 1188560 to 1188583 (24 bp); Methanoculleus marisnigri JR1 ACGGTCACGGTCGCGGTCCCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1187609-1191448	Sequence	Memar_1212 - Ig domain-containing protein (Protein is coded in complementary strand; from 1191448 to 1187609)