Sequence retrieval

Genome: Methanoculleus marisnigri JR1
Start position: 1281091
End position: 1281114
Length: 24

DNA sequence
>NC_009051, from 1281091 to 1281114 (24 bp); Methanoculleus marisnigri JR1 CTTCGCGTCTTCGCGTCTTCGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1280248-1281624	Sequence	Memar_1297 - shikimate 5-dehydrogenase (Protein is coded in complementary strand; from 1281624 to 1280248)