Sequence retrieval

Genome: Methanoculleus marisnigri JR1
Start position: 1327663
End position: 1327686
Length: 24

DNA sequence
>NC_009051, from 1327663 to 1327686 (24 bp); Methanoculleus marisnigri JR1 AGGGCAAGGGCGATGGCAAGCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1327024-1328115	Sequence	Memar_1341 - ABC-type transport system involved in multi-copper enzyme maturation permease component-like protein (Protein is coded in complementary strand; from 1328115 to 1327024)