Sequence retrieval

Genome: Methanoculleus marisnigri JR1
Start position: 1637294
End position: 1637317
Length: 24

DNA sequence
>NC_009051, from 1637294 to 1637317 (24 bp); Methanoculleus marisnigri JR1 GCGCTCCGGCGATCCGGCTCTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1637272-1638126	Sequence	Memar_1626 - DNA methylase N-4/N-6 domain-containing protein (Protein is coded in complementary strand; from 1638126 to 1637272)