Sequence retrieval

Genome: Methanoculleus marisnigri JR1
Start position: 2148359
End position: 2148382
Length: 24

DNA sequence
>NC_009051, from 2148359 to 2148382 (24 bp); Methanoculleus marisnigri JR1 GAGGTCGAGGTAGCGGTCGAGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2147538-2149079	Sequence	Memar_2154 - AMP-dependent synthetase/ligase (Protein is coded in complementary strand; from 2149079 to 2147538)