Sequence retrieval

Genome: Methanoculleus marisnigri JR1
Start position: 1248388
End position: 1248414
Length: 27

DNA sequence
>NC_009051, from 1248388 to 1248414 (27 bp); Methanoculleus marisnigri JR1 TCTCCCCGATCTCCCCGATCTCCCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1247820-1249292	Sequence	Memar_1267 - alpha-amylase (Protein is coded in complementary strand; from 1249292 to 1247820)