Sequence retrieval

Genome: Methanoculleus marisnigri JR1
Start position: 2334708
End position: 2334734
Length: 27

DNA sequence
>NC_009051, from 2334708 to 2334734 (27 bp); Methanoculleus marisnigri JR1 GCCCATGCCGCCCATGCCGCCCATGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2334694-2336355	Sequence	Memar_2346 - thermosome (Protein is coded in complementary strand; from 2336355 to 2334694)