Sequence retrieval

Genome: Methanoculleus marisnigri JR1
Start position: 1095151
End position: 1095183
Length: 33

DNA sequence
>NC_009051, from 1095151 to 1095183 (33 bp); Methanoculleus marisnigri JR1 CGACTTGGTCCCCACTTAGTCCCAACTTGGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1094934-1095302	Sequence	Memar_1108 - hypothetical protein (Protein is coded in complementary strand; from 1095302 to 1094934)