Sequence retrieval

Genome: Methanoculleus marisnigri JR1
Start position: 2388944
End position: 2388979
Length: 36

DNA sequence
>NC_009051, from 2388944 to 2388979 (36 bp); Methanoculleus marisnigri JR1 TGCTGCTGCCGTTACTGATGCCGTTGCTGCTGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2388463-2389620	Sequence	Memar_2406 - hypothetical protein (Protein is coded in complementary strand; from 2389620 to 2388463)