Sequence retrieval

Genome: Methanoculleus marisnigri JR1
Start position: 845095
End position: 845130
Length: 36

DNA sequence
>NC_009051, from 845095 to 845130 (36 bp); Methanoculleus marisnigri JR1 TTTTCTCCGAACTTTTCTCCGAACTTTTCTCCGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 844929-846293	Sequence	Memar_0868 - transcriptional regulator (Protein is coded in complementary strand; from 846293 to 844929)