Sequence retrieval

Genome: Methanoculleus marisnigri JR1
Start position: 2432659
End position: 2432712
Length: 54

DNA sequence
>NC_009051, from 2432659 to 2432712 (54 bp); Methanoculleus marisnigri JR1 TCGGCGTCCACAACGAGGTCGGCGTCCACAACGAGGTCGGCGTCCACAACGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2432386-2434065	Sequence	Memar_2456 - beta-lactamase domain-containing protein (Protein is coded in complementary strand; from 2434065 to 2432386)