Sequence retrieval

Genome: Methanoculleus marisnigri JR1
Start position: 516145
End position: 516198
Length: 54

DNA sequence
>NC_009051, from 516145 to 516198 (54 bp); Methanoculleus marisnigri JR1 CGGCGTTTCTGTCTCCATCGGTGTCTCGGTCTCCATCGGGGTCTCCGTCTCCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 515762-516319	Sequence	Memar_0533 - hypothetical protein (Protein is coded in complementary strand; from 516319 to 515762)