Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 1085863
End position: 1085886
Length: 24

DNA sequence
>NC_009142, from 1085863 to 1085886 (24 bp); Saccharopolyspora erythraea NRRL 2338 CGTTCCCGATCCCGTTCGCGGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1085281-1086204	Sequence	SACE_0971 - hypothetical protein (Protein is coded in complementary strand; from 1086204 to 1085281)