Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 126012
End position: 126035
Length: 24

DNA sequence
>NC_009142, from 126012 to 126035 (24 bp); Saccharopolyspora erythraea NRRL 2338 GCCGCGGCCGGGGCCGCTGCCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 125860-127314	Sequence	SACE_0102 - two component sensor kinase (Protein is coded in complementary strand; from 127314 to 125860)