Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 1432278
End position: 1432301
Length: 24

DNA sequence
>NC_009142, from 1432278 to 1432301 (24 bp); Saccharopolyspora erythraea NRRL 2338 GCGGCCCCGGCCGCGGCGGCGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1432083-1433201	Sequence	SACE_1300 - hypothetical protein (Protein is coded in complementary strand; from 1433201 to 1432083)