Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 1663324
End position: 1663347
Length: 24

DNA sequence
>NC_009142, from 1663324 to 1663347 (24 bp); Saccharopolyspora erythraea NRRL 2338 GCCACCGCCAGCGCGACCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1662862-1664988	Sequence	SACE_1515 - carbon starvation protein CstA (Protein is coded in complementary strand; from 1664988 to 1662862)