Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 1714859
End position: 1714882
Length: 24

DNA sequence
>NC_009142, from 1714859 to 1714882 (24 bp); Saccharopolyspora erythraea NRRL 2338 GACGTCGTCGTCGATGTCGACCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1714338-1715840	Sequence	SACE_1564 - ATPase (Protein is coded in complementary strand; from 1715840 to 1714338)