Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 1816903
End position: 1816926
Length: 24

DNA sequence
>NC_009142, from 1816903 to 1816926 (24 bp); Saccharopolyspora erythraea NRRL 2338 CGAGCACCAGCACGAGCGCGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1816524-1817258	Sequence	SACE_1649 cobS cobalamin 5'-phosphate synthase (Protein is coded in complementary strand; from 1817258 to 1816524)