Sequence retrieval

Genome: Saccharopolyspora erythraea NRRL 2338
Start position: 1826958
End position: 1826981
Length: 24

DNA sequence
>NC_009142, from 1826958 to 1826981 (24 bp); Saccharopolyspora erythraea NRRL 2338 GCGACCGCCACCGAGACCGCGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1826061-1827236	Sequence	SACE_1659 - two-component system sensor kinase (Protein is coded in complementary strand; from 1827236 to 1826061)